The detailed information of tRNA gene sequence


Sequence ID>W1910765940
Genome IDMNXG01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 11630
End posion on genome 11704
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
ctttaactaT
tRNA gene sequence
GTCCCGGTAGCTCAGCAGGTAGAGCGCACGGCTGTTAACCGTGATGTCAGAGGTTCGAGT
CCTCTCCGGGACGTta
Downstream region at tRNA end position
aaaagatgga
Secondary structure (Cloverleaf model)
>W1910765940	Asn	GTT
                   T      GTta aaaagatgga
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T G
                    T     T C T C C     A
      C G A        A      | | | | |     G
    A       C T C G       A G A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          G     ATGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK