The detailed information of tRNA gene sequence


Sequence ID>W1910803869
Genome IDMTCG01000020
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesTatumella sp. OPLPL6 (MTCG)
Start position on genome 449
End posion on genome 523
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tacgtgcaag
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tcaataagta
Secondary structure (Cloverleaf model)
>W1910803869	Arg	CCT
                   g      ACCA tcaataagta
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK