The detailed information of tRNA gene sequence


Sequence ID>W1910808510
Genome IDMUEI01000002
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus paralicheniformis KMS 80 (MUEI)
Start position on genome 1036437
End posion on genome 1036509
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
ttaaatatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
ttaaaaccct
Secondary structure (Cloverleaf model)
>W1910808510	Ala	GGC
                   c      Atct ttaaaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK