The detailed information of tRNA gene sequence


Sequence ID>W1910870301
Genome IDNCRO01000026
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium RS-JS1 (NCRO)
Start position on genome 3222
End posion on genome 3148
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gttcttggtt
tRNA gene sequence
TGGGGCGTAGCCAAGTGGTAAGGCACGGGAATTTGGATCCCGCATTCGAAGGTTCGAACC
CTTCCGCCCCAGCCA
Downstream region at tRNA end position
tataaattaa
Secondary structure (Cloverleaf model)
>W1910870301	Gln	TTG
                   t      GCCA tataaattaa
                     T - A
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          C A
                    T     C T T C C     A
        G A        A      | | | | |     G
      T     A C C G       G A A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  A       A
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK