The detailed information of tRNA gene sequence


Sequence ID>W1910870304
Genome IDNCRO01000049
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium RS-JS1 (NCRO)
Start position on genome 2757
End posion on genome 2832
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
ccccgacttt
tRNA gene sequence
GCGGGAATAGCTCAGTTGGTAGAGCACTAGCCTTCCAAGCTAGTTGTCGCGGGTTCGAGA
CCCGTTTCCCGCTCCA
Downstream region at tRNA end position
atgtaatatc
Secondary structure (Cloverleaf model)
>W1910870304	Gly	TCC
                   t      TCCA atgtaatatc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T          A G
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TTGTC
                    C - G
                    T - A
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK