The detailed information of tRNA gene sequence


Sequence ID>W1910899205
Genome IDNGJN01000002
Search identical group
Phylum/ClassBacteroidetes
SpeciesWinogradskyella sp. WNB302 (NGJN)
Start position on genome 79340
End posion on genome 79266
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ccgcaataat
tRNA gene sequence
GGCGAGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCTCGAGTTCAAT
TCTCGATCTCGCTACaa
Downstream region at tRNA end position
cagcaagagt
Secondary structure (Cloverleaf model)
>W1910899205	Met	CAT
                   t      ACaa cagcaagagt
                     G + T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G + T          T T
                    T     A G C T C     A
      T G A        A      | | | | |     A
    T       C T C G       T C G A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T + G
                    C - G
                    G - C
                    G - C
                    A   C
                  T       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK