| Sequence ID | >W1910912360 |
| Genome ID | NHPF01000090 |
| Phylum/Class | Euryarchaeota |
| Species | Halorubrum sp. Ea8 [NHPF] |
| Start position on genome | 11682 |
| End posion on genome | 11610 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
actgcgacaa |
| tRNA gene sequence |
GCCCGGATGGTGTAGTGGCCCATCATACGACCCTGTCACGGTCGTGACGCGGGTTCAAAT |
| Downstream region at tRNA end position |
cccgtttcgg |
| Secondary structure (Cloverleaf model) | >W1910912360 Asp GTC
a Gtcc cccgtttcgg
G - C
C - G
C - G
C - G
G - C
G - C
A - T T A
T C G C C C A
T G A G | | | | | A
G T G T G G C G G G C
G | | + T T
C T C A T
C C A A TGAC
C - G
G - C
A - T
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |