The detailed information of tRNA gene sequence


Sequence ID>W1910932878
Genome IDNIUC01000001
Search identical group
Phylum/ClassBacteroidetes
SpeciesAlgoriphagus sp. XAY3209 (NIUC)
Start position on genome 45866
End posion on genome 45792
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
atcggaataa
tRNA gene sequence
GCACTCGTAGTTCAACTGGATAGAATATCGGATTTCGGCTCCGAGGGTTGAGGGTTCGAA
TCCTTCCGAGTGCACaa
Downstream region at tRNA end position
agctcagact
Secondary structure (Cloverleaf model)
>W1910932878	Arg	TCG
                   a      ACaa agctcagact
                     G - C
                     C - G
                     A - T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C T T C C     A
      C A A        A      | | + | |     G
    T       C T T G       G A G G G     C
    G       | | | +                 T T
    G       G A A T
      A T A        A     GGGTT
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  T       C
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK