The detailed information of tRNA gene sequence


Sequence ID>W1911143678
Genome IDNPBC01000029
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesAfifella marina DSM 2698 (NPBC)
Start position on genome 2946
End posion on genome 2870
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gcctgcgggc
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
gccttttttc
Secondary structure (Cloverleaf model)
>W1911143678	Met	CAT
                   c      ACCA gccttttttc
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK