The detailed information of tRNA gene sequence


Sequence ID>W1911175305
Genome IDNQJZ01000056
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesErwinia amylovora EA110 (NQJZ)
Start position on genome 64058
End posion on genome 63987
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcagttcaac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACAata
Downstream region at tRNA end position
cttcacagtt
Secondary structure (Cloverleaf model)
>W1911175305	Arg	CCT
                   c      Aata cttcacagtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK