The detailed information of tRNA gene sequence


Sequence ID>W1911176868
Genome IDNQKW01000006
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. 1G10 (NQKW)
Start position on genome 109236
End posion on genome 109326
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ttcggccccT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
caagaccctg
Secondary structure (Cloverleaf model)
>W1911176868	Ser	GCT
                   T      GTtc caagaccctg
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK