The detailed information of tRNA gene sequence


Sequence ID>W1911176870
Genome IDNQKW01000006
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. 1G10 (NQKW)
Start position on genome 86859
End posion on genome 86786
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gctggagctT
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGTtc
Downstream region at tRNA end position
tgagagatcc
Secondary structure (Cloverleaf model)
>W1911176870	Gln	TTG
                   T      GTtc tgagagatcc
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK