The detailed information of tRNA gene sequence


Sequence ID>W1911176913
Genome IDNQKX01000006
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MW101C3 (NQKX)
Start position on genome 249163
End posion on genome 249244
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
tgacggccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttcccca
Secondary structure (Cloverleaf model)
>W1911176913	Leu	GAG
                   c      Attt ctcttcccca
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK