The detailed information of tRNA gene sequence


Sequence ID>W1911176923
Genome IDNQKX01000010
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MW101C3 (NQKX)
Start position on genome 95913
End posion on genome 96003
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gccagccccT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
cctggttctg
Secondary structure (Cloverleaf model)
>W1911176923	Ser	GCT
                   T      GTtc cctggttctg
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK