The detailed information of tRNA gene sequence


Sequence ID>W1911176960
Genome IDNQKY01000014
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. BO 8801 (NQKY)
Start position on genome 60257
End posion on genome 60167
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ctgtgccacT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
caggcccttc
Secondary structure (Cloverleaf model)
>W1911176960	Ser	GCT
                   T      GTtc caggcccttc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK