The detailed information of tRNA gene sequence


Sequence ID>W1911176963
Genome IDNQKY01000021
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. BO 8801 (NQKY)
Start position on genome 43396
End posion on genome 43315
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
atccgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ttcttctcca
Secondary structure (Cloverleaf model)
>W1911176963	Leu	GAG
                   c      Attt ttcttctcca
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK