The detailed information of tRNA gene sequence


Sequence ID>W1911176994
Genome IDNQKZ01000006
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. 8F6 (NQKZ)
Start position on genome 82231
End posion on genome 82321
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tcaagctgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtg
Downstream region at tRNA end position
aaaactggtt
Secondary structure (Cloverleaf model)
>W1911176994	Ser	GCT
                   T      GTtg aaaactggtt
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK