Sequence ID | >W1911281096 |
Genome ID | NTHL01000016 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 286 |
End posion on genome | 362 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gacagggttt |
tRNA gene sequence |
GGGCTAGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
ccaggcctgc |
Secondary structure (Cloverleaf model) | >W1911281096 Ile GAT t ACCA ccaggcctgc G - C G - C G - C C - G T + G A - T G - C T G T C C T C C A T G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |