Sequence ID | >W1911281097 |
Genome ID | NTHL01000016 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 397 |
End posion on genome | 472 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tctggttttt |
tRNA gene sequence |
GGGGGCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCGTCGGTTCGAAC |
Downstream region at tRNA end position |
aaaccgggtt |
Secondary structure (Cloverleaf model) | >W1911281097 Ala TGC t ACCA aaaccgggtt G - C G - C G + T G - C G - C C - G A - T C A T C T G C C A C G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |