Sequence ID | >W1911281124 |
Genome ID | NTHL01000082 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 119 |
End posion on genome | 43 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cacataccac |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCATAGGTTCAAA |
Downstream region at tRNA end position |
atgtatcctg |
Secondary structure (Cloverleaf model) | >W1911281124 Met CAT c ACCA atgtatcctg C A G - C C - G G - C G - C G - C G - C T A T T A T C C A C G A G | | | | | A C C G A G A T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |