Sequence ID | >W1911281126 |
Genome ID | NTHL01000084 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 11 |
End posion on genome | 87 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaacaccac |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGCCGCAGGTTCAAA |
Downstream region at tRNA end position |
ctgaatcccg |
Secondary structure (Cloverleaf model) | >W1911281126 Met CAT c ACCA ctgaatcccg C A G - C C - G G - C G - C G - C G - C T A T C G T C C A C G A G | | | | | A C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGCC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |