| Sequence ID | >CHL090102728 |
| Genome ID | EF067920 |
| Phylum/Class | stramenopiles |
| Species | Phaeodactylum tricornutum |
| Start position on genome | 66823 |
| End posion on genome | 66896 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aaatagaaac |
| tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCTCTGGTTCAAA |
| Downstream region at tRNA end position |
ggggtatagc |
| Secondary structure (Cloverleaf model) | >CHL090102728 Ile GAT
c Aacg ggggtatagc
G - C
G - C
G - C
C - G
T + G
A - T
T - A T A
T A G A C C A
T G A A | | | | | A
T C T C G T C T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |