The detailed information of tRNA gene sequence


Sequence ID>W1911495103
Genome IDOBMP01000002
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesRhodobacter sp. JA431 (OBMP)
Start position on genome 517917
End posion on genome 517990
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gggcgctcat
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
tctcatccga
Secondary structure (Cloverleaf model)
>W1911495103	Gly	CCC
                   t      TCCA tctcatccga
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK