Sequence ID | >W1911545067 |
Genome ID | OUND01000001 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 223 |
End posion on genome | 298 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agagcttgaa |
tRNA gene sequence |
GTCCCCTTCGTCTAGAGGCCTAGGACATCGCCCTTTCACGGCGGTAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
ctttagtgat |
Secondary structure (Cloverleaf model) | >W1911545067 Glu TTC a GCCA ctttagtgat G - C T - A C - G C - G C - G C - G T - A T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |