Sequence ID | >W1911545088 |
Genome ID | OUND01000003 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 695 |
End posion on genome | 770 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gccacctatt |
tRNA gene sequence |
AGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGAGTTCGAGT |
Downstream region at tRNA end position |
tttacggctt |
Secondary structure (Cloverleaf model) | >W1911545088 Trp CCA t GCCA tttacggctt A - T G - C G - C G - C G - C C - G G - C T G T C T C T C A T A A A | + | | | G T C T T G G G G A G C G | | + | T T G G A G C T A A GTGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |