Sequence ID | >W1911545094 |
Genome ID | OUND01000003 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 170125 |
End posion on genome | 170209 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctccctcaat |
tRNA gene sequence |
GCCGAAGTGGCGAAATCGGTAAACGCAGTTGATTCAAAATCAACCGCCTTCGGGTGTGCC |
Downstream region at tRNA end position |
taaaacattt |
Secondary structure (Cloverleaf model) | >W1911545094 Leu CAA t ACCA taaaacattt G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | G C A G C G G C C G G C G | | | T T G A C G C T A A A CGCCTTCGGGTGT G - C T - A T - A G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |