Sequence ID | >W1911545101 |
Genome ID | OUND01000005 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 238632 |
End posion on genome | 238708 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttttgatagt |
tRNA gene sequence |
GCATCCATAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tatcataaaa |
Secondary structure (Cloverleaf model) | >W1911545101 Arg ACG t GCCA tatcataaaa G - C C - G A - T T - A C - G C - G A - T T A T C T T C C A C G A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |