The detailed information of tRNA gene sequence


Sequence ID>W1911568635
Genome IDPCQJ01000006
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesErwinia billingiae MYb121 (PCQJ)
Start position on genome 43042
End posion on genome 42968
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gccgcccgct
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tctgaccgtt
Secondary structure (Cloverleaf model)
>W1911568635	Arg	CCT
                   t      ACCA tctgaccgtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK