The detailed information of tRNA gene sequence


Sequence ID>W1911582809
Genome IDPHQU01000001
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. BS56D (PHQU)
Start position on genome 415106
End posion on genome 415196
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gcgagccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtg
Downstream region at tRNA end position
acttaatcga
Secondary structure (Cloverleaf model)
>W1911582809	Ser	GCT
                   T      GTtg acttaatcga
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK