The detailed information of tRNA gene sequence


Sequence ID>W1911582811
Genome IDPHQU01000001
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. BS56D (PHQU)
Start position on genome 392875
End posion on genome 392804
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tcggagtcaa
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGttt
Downstream region at tRNA end position
ttccggttcg
Secondary structure (Cloverleaf model)
>W1911582811	Gln	TTG
                   a      Gttt ttccggttcg
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK