The detailed information of tRNA gene sequence


Sequence ID>W1911638507
Genome IDPVWP01000007
Search identical group
Phylum/ClassCyanobacteria
SpeciesAphanothece cf. minutissima CCALA 015 (PVWP)
Start position on genome 60308
End posion on genome 60218
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ctgggccacT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
caggccctgc
Secondary structure (Cloverleaf model)
>W1911638507	Ser	GCT
                   T      GTtc caggccctgc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK