The detailed information of tRNA gene sequence


Sequence ID>W1911638515
Genome IDPVWP01000011
Search identical group
Phylum/ClassCyanobacteria
SpeciesAphanothece cf. minutissima CCALA 015 (PVWP)
Start position on genome 34481
End posion on genome 34400
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
ctccgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttttccc
Secondary structure (Cloverleaf model)
>W1911638515	Leu	GAG
                   c      Attt ctcttttccc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK