The detailed information of tRNA gene sequence


Sequence ID>W1911680771
Genome IDQJKK01000004
Search identical group
Phylum/ClassFirmicutes
SpeciesThermoflavimicrobium sp. FBKL4.011 (QJKK)
Start position on genome 156452
End posion on genome 156377
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
aactatatat
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
aattgtctac
Secondary structure (Cloverleaf model)
>W1911680771	Ala	GGC
                   t      ACCA aattgtctac
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK