The detailed information of tRNA gene sequence


Sequence ID>W1911718427
Genome IDQQWI01000014
Search identical group
Phylum/ClassFirmicutes
SpeciesFusibacter sp. A1 (QQWI)
Start position on genome 62055
End posion on genome 62131
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
aaacctatgt
tRNA gene sequence
GGGCGTATAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG
TCCACTTATGCCCACCA
Downstream region at tRNA end position
catattttac
Secondary structure (Cloverleaf model)
>W1911718427	Ile	GAT
                   t      ACCA catattttac
                     G - C
                     G - C
                     G - C
                     C - G
                     G + T
                     T - A
                     A - T          T G
                    T     T C A C C     A
      C G A        A      + | | | |     G
    T       C T C G       G G T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK