The detailed information of tRNA gene sequence


Sequence ID>W1911719019
Genome IDQQWV01000013
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. ABOLH S-NIH.Pt17_1112 (QQWV)
Start position on genome 15283
End posion on genome 15207
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgaccgcct
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
gatttaccgt
Secondary structure (Cloverleaf model)
>W1911719019	Arg	CCT
                   t      ACCA gatttaccgt
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK