| Sequence ID | >W1911722806 |
| Genome ID | QREL01000002 |
| Phylum/Class | Euryarchaeota |
| Species | Methanothermobacter defluvii DSM 7466 [QREL] |
| Start position on genome | 305280 |
| End posion on genome | 305209 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gtcacactga |
| tRNA gene sequence |
GGGCCGGTGGTCTAGGGGTATGATACCTCGCTTACAACGAGGTGGTCACGAGTTCGAATC |
| Downstream region at tRNA end position |
attattcttc |
| Secondary structure (Cloverleaf model) | >W1911722806 Val TAC
a Attt attattcttc
G - C
G - C
G - C
C - G
C - G
G - C
G - C T A
T T G C T C A
G A G | | | | | G
G T C T G A C G A G C
G | | + T T
G T G A T
T A A TGGTC
C - G
C - G
T - A
C - G
G - C
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |