The detailed information of tRNA gene sequence


Sequence ID>W1911749382
Genome IDQWGE01000007
Search identical group
Phylum/ClassBacteroidetes
SpeciesPontibacter sp. KIRAN (QWGE)
Start position on genome 171758
End posion on genome 171831
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
atgcggagat
tRNA gene sequence
TGTCCGATGGTGTAACTGGCAACACGTCTGATTTTGGTTCAGAAGAGTCCAGGTTCGAGC
CCTGGTCGGACAACtt
Downstream region at tRNA end position
taaaaagaac
Secondary structure (Cloverleaf model)
>W1911749382	Gln	TTG
                   t      ACtt taaaaagaac
                     T - A
                     G - C
                     T - A
                     C - G
                     C - G
                     G - C
                     A - T          C G
                    T     G G T C C     A
      C A A        G      | | | | |     G
    T       T G T G       C C A G G     C
    G       | | | |                 T T
    G       A C A C
      C A          G     AGAGT
                    T - A
                    C - G
                    T - A
                    G - C
                    A - T
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK