The detailed information of tRNA gene sequence


Sequence ID>W1911783449
Genome IDQXTH01000004
Search identical group
Phylum/ClassActinobacteria
SpeciesPromicromonosporaceae bacterium CFH 30434 (QXTH)
Start position on genome 39780
End posion on genome 39853
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
accggacgat
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
cgaggaacgg
Secondary structure (Cloverleaf model)
>W1911783449	Gly	CCC
                   t      TCCA cgaggaacgg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK