The detailed information of tRNA gene sequence


Sequence ID>W1810053911
Genome IDPDET01000002
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea coffeiphila 342 (PDET)
Start position on genome 17266
End posion on genome 17192
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tcccgccgct
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tttcgacatt
Secondary structure (Cloverleaf model)
>W1810053911	Arg	CCT
                   t      ACCA tttcgacatt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK