The detailed information of tRNA gene sequence


Sequence ID>W1810058354
Genome IDPDJJ01000001
Search identical group
Phylum/ClassActinobacteria
SpeciesIsoptericola jiangsuensis DSM 21863 (PDJJ)
Start position on genome 436895
End posion on genome 436822
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggacgtccgt
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
gtacaaagcc
Secondary structure (Cloverleaf model)
>W1810058354	Gly	CCC
                   t      TCCA gtacaaagcc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK