The detailed information of tRNA gene sequence


Sequence ID>W1810062192
Genome IDPDNX01000007
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris sp. ZM (PDNX)
Start position on genome 1637496
End posion on genome 1637421
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
ggtttctatG
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCtg
Downstream region at tRNA end position
tgtattgttg
Secondary structure (Cloverleaf model)
>W1810062192	His	GTG
                   G      CCtg tgtattgttg
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK