The detailed information of tRNA gene sequence


Sequence ID>W1810062278
Genome IDPDNZ01000005
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris sp. V1 (PDNZ)
Start position on genome 49576
End posion on genome 49651
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
atttttaatG
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCtc
Downstream region at tRNA end position
ttgggtgcct
Secondary structure (Cloverleaf model)
>W1810062278	His	GTG
                   G      CCtc ttgggtgcct
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK