The detailed information of tRNA gene sequence


Sequence ID>W1810069099
Genome IDPEBA01000051
Search identical group
Phylum/ClassBacteroidetes
SpeciesSphingobacterium sp. 1.A.5 (PEBA)
Start position on genome 369
End posion on genome 445
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
gagataagct
tRNA gene sequence
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCAGCAGTTCAAG
TCTGCTCGGGACTACCA
Downstream region at tRNA end position
ccgcggggaa
Secondary structure (Cloverleaf model)
>W1810069099	Ile	GAT
                   t      ACCA ccgcggggaa
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK