The detailed information of tRNA gene sequence


Sequence ID>W1810071451
Genome IDPEES01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesEnterobacteriaceae bacterium JKS000233 (PEES)
Start position on genome 549003
End posion on genome 548929
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgcccggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
gttaattgcc
Secondary structure (Cloverleaf model)
>W1810071451	Arg	CCT
                   c      ACCA gttaattgcc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK