Sequence ID | >W1810076250 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 265254 |
End posion on genome | 265181 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
atctagtttt |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCATCAGCCTTCCAAGCTGAATGTCGCGGGTTCGAGC |
Downstream region at tRNA end position |
acaagcatag |
Secondary structure (Cloverleaf model) | >W1810076250 Gly TCC t TCtc acaagcatag G - C C - G G - C G - C G - C A - T G - C C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |