Sequence ID | >W1810076256 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 83722 |
End posion on genome | 83648 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccctcaaaaa |
tRNA gene sequence |
GGTCCGGTAGTTCAGCTGGTTAGAATACGTGCCTGTCACGCACGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tagatagtat |
Secondary structure (Cloverleaf model) | >W1810076256 Asp GTC a GCta tagatagtat G - C G - C T - A C - G C - G G - C G - C T G T T G C C C A C G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G G - C T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |