The detailed information of tRNA gene sequence


Sequence ID>W1810093386
Genome IDPGIF01000002
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesCitrobacter koseri YDC582 (PGIF)
Start position on genome 503413
End posion on genome 503487
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gtgccgcctc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tacatacctc
Secondary structure (Cloverleaf model)
>W1810093386	Arg	CCT
                   c      ACCA tacatacctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK