The detailed information of tRNA gene sequence


Sequence ID>W1810102083
Genome IDPGTZ01000007
Search identical group
Phylum/ClassActinobacteria
SpeciesLuteimicrobium subarcticum DSM 22413 (PGTZ)
Start position on genome 192014
End posion on genome 191943
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
acggtgtctt
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCgc
Downstream region at tRNA end position
agcacgaagg
Secondary structure (Cloverleaf model)
>W1810102083	Gly	CCC
                   t      TCgc agcacgaagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK