The detailed information of tRNA gene sequence


Sequence ID>W1810147229
Genome IDPIQI01000011
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea rodasii DSM 26611 (PIQI)
Start position on genome 887662
End posion on genome 887736
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tgcgcgccgc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
gttcagacat
Secondary structure (Cloverleaf model)
>W1810147229	Arg	CCT
                   c      ACCA gttcagacat
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK