The detailed information of tRNA gene sequence


Sequence ID>W1810153822
Genome IDPIYO01000024
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesKlebsiella pneumoniae KP1 (PIYO)
Start position on genome 43268
End posion on genome 43342
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
taagttctat
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tataaacgtt
Secondary structure (Cloverleaf model)
>W1810153822	Arg	CCT
                   t      ACCA tataaacgtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK